Содержание

Астра желтая (57 фото)

Хризантема Кремист Вайт


Хризантемы фон


Розовые астры


Астра Хризантема георгин


Астры белые желтые


Хризантемы пыльца


Желтая Хризантема щетинистая


Хризантема мультифлора желтая


Желтые цветы высокие кустом типа астр


Хризантема Даф Еллоу


Астра осенняя желтая


Хризантема Белоснежка однолетник


Хризантема Аламос Еллоу


Хризантемы игольчатые желтые


Обои Астра 2


Хризантема мультифлора Жаклин Еллоу


Астра оранжевая


Осенние цветы астры хризантемы


Астра желто красная


Хризантема Эльф Йеллоу


Фотообои астры желтые


Астра цветок лепесточки


Желтая Хризантема Макросъемка


Хризантема Арлекин желтый


Астры желтые с фиолетовым


Астры картинки


Астра лимонная


Хризантема с желтыми лепестками


Жовта Хризантема


Хризантема помпон Йеллоу


Хризантема Марица


Астры колючие


Хризантема желтая крупная


Желтые хризантемы в саду


Обои мир астры


Хризантема корейская желтая игольчатая


Хризантема солнцецвет


Астра Евразия желтая


Самые красивые хризантемы


Хризантема Cosmo Yellow Impr


Хризантема София


Хризантема одноголовая желтая


Хризантема страйк Еллоу белая


Хризантема Веселинка


Астры обои


Хризантема Эвра


Хризантема желтая Голден


Желтые хризантемы


Хризантема Копикет Еллоу


Хризантема корейская желтая Венди Елоу


Красивые астры


Жёлтая Хризантема символ


Хризантема Венди Еллоу


Желтые астры букет


Хризантемы лето золотое


Хризантема Еллоу страйк


Георгина помпонная желтая

Астра желтая — 61 фото

1

Королевская Хризантема


2

Хризантема корейская Анастасия желтая


3

Астра букет микс махровая


4

Хризантема резолют


5

Астра Букетная желтая


6

Хризантема помпонная желтая


7

Хризантема корейская Меотида


8

Хризантема Венди ВЕЛОУ


9

Хризантема Белоснежка однолетник


10

Астра пионовидная Дюшес


11

Желтые осенние цветы


12

Хризантема Wonder Yellow


13

Хризантема Ambre


14

Цветы хризантемы


15

Полиплоидные хризантемы


16

Цветы хризантемы


17

Лучистая Астра


18

Хризантема Кеймен Еллоу


19

Астра леди Корал желтая


20

Хризантема Колумбия Гермес желтый


21

Астры желтые игольчатые


22

Астра китайская открытый грунт


23

Хризантема Кремист Еллоу


24

Хризантема Мираж


25

Хризантемы сентябринки


26

Хризантема Heidi Yellow


27

Астра Старлетта


28

Хризантемы леолор Роуз


29

Астра желтая хризантемовидная


30

Желтые солнечные цветы


31

Хризантемы корейские светлых оттенков


32

Астра цветок желтая


33

Хризантема Минка


34


35

Хризантема Littleton Yellow


36

Аста желтая игольчатая


37

Аста желтая игольчатая


38

Астра желтая каллистефус


39

Астра помпонная желтая


40

Хризантема Марица


41

Хризантема Migoli


42

Хризантема Эмма


43

Астра Букетная желтая


44

Астра Букетная желтая


45

Астра однолетняя принцесс


46

Осенние цветы однолетки


47

Астры и хризантемы


48

Хризантема Еллоу страйк


49

Хризантема Кремист Еллоу


50

Цветы однолетники желтые хризантемы


51

Желтые хризантемы


52

Хризантема корейская Хейди Еллоу


53

Желто-розовые хризантемы


54

Георгины хризантемы


55

Хризантема игольчатая макро


56

Хризантема сорт Миатида


57

Астра балун Еллоу


58

Пионы астры георгины


59

Астра осенняя желтая


60

Wonder Yellow Хризантема сорт

Сад Шубиной


Многолетние астры — корневищные растения, корневище горизонтальное, ветвистое, стебли прямые и в зависимости от вида высота их бывает от 20см до двух метров. Листья простые, ланцетовидной формы, очередные, чаще цельнокрайние, но иногда бывают зубчатыми. Они довольно крупные, а к верхушке побега становятся мельче. Цветки собраны в цветочные корзинки, а те в щиток, зонтик или метелку. Соцветия бывают махровые или немахровые, по размерам они составляют от 1.5 до 8см в диаметре. Язычковые цветки разнообразной окраски. В зависимости от вида и сорта они бывают белыми, розовыми, лиловыми, сиреневыми, красными, пурпурно-фиолетовыми, пурпуровыми, синеватыми и кремовыми. Трубчатые цветки чаще всего желтые. Плод — семянка. Семена плоские, обратнояйцевидные. Одни виды многолетней астры цветут весной и в начале лета (май — июнь), другие — поздним летом и осенью (август, сентябрь, октябрь).

АСТРА НОВОБЕЛЬГИЙСКАЯ

Интересное холодостойкое растение. Кусты от 40 до 150см высоты, сильно разветвленные, голые или волосистые, в зависимости от сорта. Кусты густооблиственные. Листья линейно-ланцетные с тупыми основаниями, очередные, сидячие. Соцветие до 2.2см в диаметре. Язычковые цветки многочисленные, чаще всего лиловые. Соцветия собраны в метелку. Некоторые сорта имеют другую окраску, у некоторых язычковые цветки расположены в несколько рядов, полностью прикрывая желтые трубчатые цветки, что создает впечатление махровости. Этот вид при хороших почвенных условиях цветет очень обильно и продолжительно с сентября. Соцветия астры новобельгийской широко используют на срез для разнообразных аранжировок и букетов. В воде срезанные соцветия могут стоять 10÷15 дней, если систематически менять воду, а у стеблей, опущенных в воду, удалять листья. иногда в воду опускают серебряную монету, чтобы вода не портилась. Можно для питания опустить в воду чайную ложку сахара, таблетку аспирина, кристаллик перманганата калия. Как декоративное красивоцветущее растение астру используют для разнообразных посадок на фоне зеленого газона. Фоном могут служить группы кустарников. Астры не стоит высаживать совместно с мелкими многолетниками, ибо они будут заглушены астрами.

АСТРА АЛЬПИЙСКАЯ

Невысокое кустистое растение, 20÷25см высоты. Стебли слегка опушены, крепкие, хорошо облиственны, прикорневые листья опушены, они продолговато-лопатчатые, стеблевые листья довольно мелкие, сидячие, очередные, линейно-ланцетные, зеленые. Соцветие — одиночная корзинка, 4см в диаметре. Язычковые цветки, в зависимости от сорта, — белые, голубые, сиреневые, фиолетовые, а срединные трубчатые цветки — желтого цвета. Плод — семянка с волосистым хохолком. Цветет в мае — июне. Размножается семенами, посевом в открытый грунт в гряды. Чаще всего используется для бордюров, групп на переднем плане, в миксбордерах.

Астра альпийская белая

Астра альпийская сиреневая

АСТРА НОВОАНГЛИЙСКАЯ

Куст достигает двух метров высоты. Стебли прямые, многочисленные, хорошо облиственные, в верхней половине ветвящиеся, внизу иногда слега одревесневшие. Листья ланцетные, зеленые, шершавые, опушены. Цветки собраны в соцветие-корзинку, 3÷4см в диаметре. Собраны по 25÷30шт. в короткие, густые кисти. Язычковые цветки — розовые, лиловые, фиолетовые, красные или темно-синие. трубчатые цветки — желтые, у некоторых сортов — красноватые или пурпурные. Все сорта астры новоанглийской цветут осенью, в сентябре — октябре, некоторые выдерживают заморозки до -5°C. Различные сорта используют на срез и для обсадки. Многочисленные сорта различны по времени цветения, размерам и окраске соцветий. Соцветия используются для различных букетов и аранжировок, одиночно или декорируют аранжировки ветками спаржи, магонии, букуса и т.п. В воде соцветия стоят 10÷12 дней. За срезанными соцветиями также должен быть уход: смена воды, подрезка кончиков веток, срезка листьев с участков побегов, находящихся в воде. Подкормки специальными питательными растворами продлят жизнь срезанных цветов. Разнообразно используют для обсадки, одиночно, группами и т.п.

См. далее: Агротехника астры многолетней
См. далее: Болезни астры многолетней

[7] Тавлинова Г.К. Астры. Москва — Санкт-Петербург. Центрполиграф. МиМ-Дельта. 2004.

Каталог скинали – Желтые астры №a-1820

Каталог скинали – Желтые астры №a-1820

Бесплатный замер

Пожизненная гарантия

Оплата наличными и через расчетный счет

Выполнение заказа не более 10 дней!

Секрет стильного интерьера кухни — в деталях. Это пространство может быть не только рабочей зоной для готовки и приема пищи, но и ярким пространством с оригинальным оформлением. Добиться этого легко с помощью скинали — стеклянного фартука, для которого можно выбрать любое изображение. Желтые астры — идеальный вариант для ценителей свежести, которую всегда приносят с собой растения, появляясь в интерьере. Помещение полностью преобразится и наполнится уютом, находиться в нем станет гораздо приятнее. Панель легко монтируется и неприхотлива в уходе. Плюс она абсолютно безопасна, так как разбить материал очень сложно.

Похожие изображения

Поля, отмеченные «*», обязательны для заполнения.

Вы можете увидеть как данное изображение будет выглядеть в интерьере вашей кухни.

Для этого перейдите на страницу «Примерка», загрузите туда фотографию своей кухни и отметтье место расположения будущего кухонного фартука.

Вы уже загрузили изображение своей кухни, однако вам нужно определить место расположения кухонного фартука на нее на странице «Примерка»

Подождите идет обработка

[contact-form-7 title=»Заказать обратный звонок»]

как и когда сажать астры

Астру не зря называют королевой осени, ведь когда в саду остаются лишь только хризантемы, астра только начинает свое цветение. Выращивание астр – это очень увлекательное занятие, ведь из крошечных семян вырастают за лето прекрасные цветы, которые радуют обильным и пышным цветением на протяжении всей осени. Все без исключения садоводы любят астры, так как эти декоративные цветы украшают сад и не требуют хлопотного и кропотливого ухода.

Описание растения

Относится растение к роду травянистых многолетних. Состоит род более, чем из 600 видов. Распространено растение в качестве декоративного. Высотой астры могут достигать до 1,6 метра. У астры мочковатая корневая система, корни расположены очень близко к поверхности земли – на глубине всего лишь 20 см. Стебель у растения прямой, прочный, покрыт волосками. Листья простые, темно-зеленого цвета.

Соцветия астры – это корзинки, которые могут быть собраны в метелки. Диаметр соцветий от 1 до 6 см. Соцветия могут быть самой разнообразной окраски. Форма лепестков простая, полумахровая, кудрявая или махровая. Семена растения мелкие, темного цвета или светло-желтого.

Этот цветок попал к нам из Китая еще в 17 веке. С тех пор в наших палисадниках растет осенняя астра, и радует глаз ярким цветением. Но впервые эти цветы появились в Греции, и в переводе с греческого астра означает звезда. Выведено множество декоративных сортов, и в зависимости от высоты растения астры используют для оформления осенних клумб, для бордюров, для украшения террас, высаживают их в рокариях. Растение великолепно смотрится в групповых посадках. Как сажать астры и что любят эти цветы?

Выбор участка для посадки

Если вы изначально правильно подберете участок для посадки астр, то в дальнейшем весь уход за этими цветами будет сведен лишь к прополке, редким подкормкам и поливу. Отлично астра чувствует себя в полутени или на солнечном месте. То если вы живете в жарком регионе, то все же лучше посадить астры в полутени либо притенять их от солнца.

Палящие солнечные лучи негативно воздействуют на это растение, так как нежные листья могут получить ожоги, а сам цветок потерять яркость красок.

Также при выборе участка отдайте предпочтение месту, защищенному от сквозняков, холодных потоков ветра. Северная сторона приусадебного участка и места за сооружениями для астры не подходят. Дело в том, что из-за переохлаждения астра может заболеть. Отлично, если выбранный для посадки астры участок будет находиться на небольшой возвышенности, так как тогда грунтовые воды не навредят растению.

Посадка рассадным способом

Если вы стремитесь получить очень раннее цветение, то попробуйте вырастить цветок рассадным способом. На рассаду семена надо высевать в начале апреля, хотя некоторые цветоводы практикуют посев семян в марте, чтобы получить уже летом цветущую астру.

  • Высевать на рассаду семена астры надо в предварительно заготовленные контейнеры. В ящики засыпают смесь, составленную из листовой земли, дерновой земли и песка. Обязательно пролейте землю в ящиках слабым раствором марганцовки, чтобы рассада не заболела. После этого можно приступать к подготовке семян и их посеву в грунт.
  • Растворите в небольшой емкости в воде порошок фунгицида и замочите в ней семена. Такая процедура поможет увеличить всхожесть. Вымоченные семена на протяжении получаса высевают в подготовленные ящики. Семена надо распределить по поверхности грунта и присыпать тонким слоем речного песка.
  • После прорастания семян рассаду надо пикировать. Для этого выбирают молодые растения, на которых есть два-три настоящих листочка и пересаживают их в грунт в отдельные горшки. Грунт можно взять в саду, но следует добавить в него немного комплексных минеральных удобрений. Очень любит этот цветок удобрения с азотом, а потому еще не окрепшую рассаду перед тем, как перенести в открытый грунт следует подкормить удобрениями с азотом.
  • После пикировки растеньица надо хорошенько полить и поставить на освещенное солнцем место. Температура воздуха в помещении должна быть не ниже 22 градусов тепла. Уже в середине мая этот цветок, появившийся из крошечных семян, можно высаживать в открытый грунт на даче или приусадебном участке. В мае-июне можно садить рассаду на постоянное место в саду.

Особенности посадки рассады

Многие цветоводы не могут добиться пышного цветения своих растений, потому что не могут точно определить, когда сажать астры на даче или на клумбу, и как правильно это сделать. От правильной посадки напрямую зависит, насколько ваши астры быстро приживутся и будут ли они хорошо цвести.
Посадка астр начинается с подготовки грядки и внесения подкормок в лунки. Подкормить астру при посадке можно органическими или минеральными удобрениями. В каждую лунку насыпают немного удобрения, смешивают его с землей. Затем высаживают рассаду, заглубляя ее на 2 см больше, чем она была в ящиках. Между растениями надо оставлять около 20 см. После того, как вы высадите рассаду, между рядами следует сделать неглубокий ров, в который надо залить воду. После высадки астру надо окучивать, чтобы растения быстрее росли и были более крепкими.

Когда делать посев астр?

Этот цветок выращивают из семян. Посев крошечных семян в открытый грунт можно проводить сразу в три срока:

  1. Посеять семена можно ранней весной сразу в открытый грунт. Выращивание астр начинается уже с апреля, когда воздух и земля немного прогреются. Если у вас на участке легкая, плодородная почва, то посев можно начинать уже с первой половины апреля. Если же на даче или приусадебном участке земля – это тяжелый суглинок, то посев семян надо отложить до середины мая. Ранний посев семян в открытый грунт рекомендован для сортов, которые годятся для срезки.
  2. Сеять семена астр в открытый грунт можно и осенью, под зиму. Обычно этот период приходится на середину ноября. Так как почва уже будет слишком холодной, то посеянные семена надо прикрыть сверху небольшим слоем перегноя или торфа. Семена прорастут только весной.
  3. Еще астру можно сеять зимой. Посев можно проводить в январе. Семена просто разбрасывают прямо по снегу. Когда снег начнет сходить, семена сами лягут на землю, и весной прорастут. При таком посеве семена пройдут естественную стратификацию.

На несколько минут семена перед посевом надо замочить в растворе абсолютно любого фунгицида. Затем семена слегка просушивают и высевают в открытый грунт. Равномерно распределите мелкие семена по поверхности почвы. Сверху семена присыпают речным песком, а затем прикрывают пленкой, чтобы создать эффект парника. Грунт, в который вы будете сеять астру, должен обязательно быть влажным. Ежедневно такие теплички проветривают, поливают только по мере необходимости из распылителя, чтобы не повредить струей воды нежные ростки.

Семена астры прорастают очень быстро – уже на 5-6 день можно увидеть крошечные ростки, которые буквально за лето превратятся в пышно цветущие, очень красивые осенние цветы. Посадка астр многолетних сортов семенами сразу в грунт для многих цветоводов проще и предпочтительней.

Посев семян сразу в грунт

Как вырастить астры из семян сразу в открытом грунте? Можно сразу же посеять семенами на даче в открытый грунт, но в таком случае их всхожесть будет намного меньше. Вырастить астру из семян можно, посеяв семена сразу же в грунт на даче в конце апреля или же в начале мая. Очень важно правильно подготовить грядку – земля на ней должна быть рыхлой, плодородной и обязательно дренированной. Если вы будете выращивать астру из семян сразу в открытом грунте на даче, то уже к концу лета или в начале осени вы увидите результат своих стараний. Чаще всего у себя на даче или на приусадебных участках, на клумбах в парках семена астры сеют прямо в открытый грунт. Хотя многие предпочитают садить астру рассадой.

Уход за растениями

Уход за астрами очень прост и заключается в регулярных поливах, прополках грядок, внесении подкормок и в рыхлении почвы после дождя и поливов. Ухаживать за этими цветами очень просто, за что и любят цветоводы эти декоративные растения.

При поливах учтите, что это растение не слишком любит избыток влаги и не переносит заболоченность почвы. Если лето будет дождливым, то астру можно вовсе не поливать.

Подкормки

Астру надо несколько раз подкормить за сезон. Первый раз вносят удобрения в период появления ростков. После этой подкормки в период формирования бутонов снова надо внести удобрения. В период активного роста растений под них надо внести раствор из 5 гр. азота, 4 гр. фосфата, 4 гр. калий на 4 литра воды. В период формирования бутонов вносят любое удобрение, включающее калий и фосфор.

Подготовка астр к зимовке

Многолетние декоративные осенние красавицы могу перезимовать и без укрытия. Это огромное преимущество этих цветов по сравнению со многими другими обитателями сада. Все, что надо сделать перед зимовкой – это обрезать побеги и замульчировать почву торфом или опилками, перегноем. Садовая астра – это очень неприхотливое растение.

Вредители и болезни

  1. Садовая астра очень часто поражается черной ножкой, которая развивается в период активного роста растений. Эта болезнь может быть из-за слишком густых посадок. Чтобы избавить астры от этого заболевания, следует обработать побеги пеплом или препаратом Превикур.
  2. Из-за повышенной влажности на цветах может развиться мучнистая роса или ржавчина, появиться фузариоз. Для лечения этих заболеваний следует обрабатывать цветы препаратами Татту или Ридомил Голд.
  3. Из вредителей астра больше всего боится тлю и паутинного клеща. В борьбе с такими вредителями помогают обработки растений препаратами Актофит и Актеллик. Данные препараты безвредны для пчел и человека.
  4. Злостный вредитель астр огневка появляется в августе. Огневка откладывает яйца на бутонах растений. Гусеницы, вылупляющиеся из яиц, поедают соцветия. Чтобы избавиться от этого вредителя, астры следует обработать Актофитом.

Аастра в ландшафтном дизайне

Всего насчитывается более 4 тысяч сортов этого прекрасного цветка. Осенние астры могут быть желтые, синие, красные, лиловые, фиолетовые… Все оттенки этих чудесных осенних цветов просто невозможно перечислить. Садовая астра фиолетовая или синяя может стать солистом на клумбе с желтыми или голубыми цветами. Красная осенняя красавица поможет сделать главный акцент на клумбе в осеннем саду. Розовая астра выглядит очень нежно на фоне белых цветов и сочной зелени газона. Астры способны украсить любой сад!

  • Очень красивого выглядит красная и розовая астра на фоне зелени лилейников и удлиненных листов ириса бородатого. Прекрасно смотрятся цветущие астры на фоне пышно цветущих в это же время хризантем.
  • Астра может стать лидером на осенней клумбе. Вы можете высадить на одном участке разные по сроку цветения и цвету бутонов астры, что позволит вашему цветнику выглядеть нарядно продолжительное время.
  • При устройстве рокариев и альпийских горок астры – это незаменимые цветы. Прекрасное дополнение ландшафта в саду с камнями – это астры, буйно цветущие на фоне осени.
  • Очень часто низкорослые сорта этих цветов высаживают в качестве живых бордюров вдоль садовых дорожек и клумб с высокорослыми растениями. Если высадить эти цветы в плотный ряд, то можно добиться очень плотного обрамления любого участка.
  • Из астр можно легко создать яркую цветущую композицию, если высадить разные по цвету бутонов сорта. При правильно подобранных цветах астры можно добиться потрясающих сочетаний. Астры очень долго цветут, за что их любят ландшафтные дизайнеры.

Обязательно посадите у себя на участке красавицы-астры, которые не будут требовать от вас хлопотного ухода, зато осенью разукрасят ваш сад разноцветными красками. Растение прекрасно подходит для составления букетов.

Как предотвратить желтизну астр и справиться с ней

Фитоплазма

Желтуха астр – разрушительное заболевание, поражающее более 300 видов растений. И это касается только широколиственных растений! Желтизна астр также поражает зерновые культуры, такие как пшеница и ячмень.

Без эффективного лечения болезнь может быстро выйти из-под контроля.

Астра желтая встречается в Северной Америке, Европе и большей части умеренных зон мира.

К сожалению, это неизлечимое состояние.

Мы связываемся с поставщиками, чтобы помочь вам найти соответствующие продукты. Если вы покупаете по одной из наших ссылок  , мы можем получить комиссию .

Лучшее, что можно сделать с зараженным растением, это убрать его из сада, чтобы болезнь не распространилась.

Читайте дальше, чтобы узнать, как предотвратить заражение ваших растений этим пагубным организмом, и как справиться с ним, если он все же возникнет.

Что такое болезнь желтой астры?

Желтизна астр вызывается микроскопическими организмами, называемыми фитоплазмами, которые очень похожи на бактерии.

Это заболевание не угрожало бы вашим растениям, если бы не астровая цикадка ( Macrosteles quadrilineatus ). Как следует из названия, это живое насекомое, которое прыгает с растения на растение, распространяя болезнь.

Астра листовертка ( Macrosteles quadrilineatus ). Фотография предоставлена ​​Уитни Крэншоу, Университет штата Колорадо Bugwood.org, через CC BY-SA. Обрезано.

Возбудитель болезни находится в соке инфицированных растений. Когда насекомое питается, оно всасывает эту фитоплазму, передавая ее соседним растениям.Цикадка может вызвать инфекцию всего за 1-3 недели и передает желтую астру каждый раз, когда кормится до конца своей жизни.

Попав в растение, фитоплазма распространяется по всему растению от корня до цветов. Вам потребуется некоторое время, чтобы понять, что ваши растения заражены, так как они обычно не проявляют симптомов в течение 10-40 дней после заражения.

Несмотря на то, что микроорганизм, вызывающий желтизну астр, не убивает своих хозяев (если только они не молоды), он так их уродует, что вам больше не нужны растения в вашем саду.Если вы выращиваете восприимчивые овощи, ваш урожай будет поврежден.

Растения, которые могут заразиться

Распространенные цветущие декоративные растения, которые могут заразиться, включают:

Восприимчивые овощи включают:

Большое разнообразие сорняков, в том числе подорожник , одуванчик , чертополох и амброзия могут служить резервуаром для астровых желтух.

Симптомы желтой астры

Это заболевание получило свое название от астр, так как они являются одним из видов растений, на которых желтушность астр проявляется ярко выраженными отличительными симптомами.Цветы, похожие на маргаритки, могут быть преобразованы в гротескные сооружения.

Например, цветы астры, маргаритки, эхинацеи, хризантемы могут иметь пучки деформированных листьев внутри или вместо них. Еще один распространенный симптом — листья желтеют, а жилки остаются зелеными.

Другие симптомы включают задержку роста, аномально густой рост, молодые листья, которые желтеют, а также скручивание или скручивание листвы. Кроме того, цветы могут не дать семян.

Симптомы могут различаться

Еще больше усложняет ситуацию тот факт, что этот патоген вызывает разные симптомы на разных типах растений.

Корни моркови могут быть опушенными и горькими, в то время как внутренние листья салата могут быть скрученными, а на любом из листьев могут быть коричневые или розовые пятна. Болезнь часто называют «фиолетовой верхушкой» картофеля, потому что листва часто становится пурпурной.

Астра желтеет на картофеле, ее часто называют «фиолетовой верхушкой» из-за пурпурной исчерченности листьев. Фото через Алами.

Симптомы более заметны в жаркую погоду, растения могут заражаться в прохладную погоду без каких-либо симптомов. Это особенно прискорбно, так как болезнь может широко распространяться в прохладное и влажное лето.

Другие факторы, которые могут вызывать изменения симптомов, включают возраст и/или размер растения на момент заражения. Растения, которые заражены, когда они маленькие, как правило, низкорослые и имеют другие листья, которые могут иметь розетки или уже, чем здоровые листья.

Факторы, которые могут вызывать похожие симптомы

Не каждое растение, имеющее деформированный вид, заражено желтухой астры.

Повреждение гербицидами также может проявляться этими симптомами. Это особенно верно, когда растения были обработаны Weed ‘n’ Feed, комбинированным удобрением и гербицидом, обычно используемым на газонах для борьбы с широколиственными сорняками.

Ведьмина метла, уродство, вызываемое растениями-паразитами, может вызывать аналогичные симптомы.

А эхинацеи могут быть атакованы эриофиидными клещами, которые вызывают пучки мелких деформированных частей цветка, которые вырастают из шишки.

Астровые цикадки любят путешествовать

Цикадки-переносчики этого заболевания не могут пережить холодные зимы, как это бывает с садоводами в Миннесоте (хотя их яйца могут выжить в северной части Среднего Запада). Однако жестокие холодные зимы не приводят к их гибели.

Листовертка на стебле травы. Фото через Shutterstock.

В пределах Северной Америки насекомые перемещаются в Мексиканский залив, где популяции достигают высоких уровней на зерновых полях в Миссури и Арканзасе.

Перезимовав там, они улетают в верхние слои атмосферы, где штормовые системы могут уносить их на сотни миль к северу и досаждать северным садоводам.

В некоторые годы зараженные цикадки прилетают ранней весной, еще до того, как местная популяция насекомых успела заразиться.Впрочем, учитывая капризы погоды, в другие годы они не проблема.

Жаркая погода может сдерживать болезнь

К счастью для садоводов в жарком климате, высокие температуры инактивируют патоген как в цикадке, так и в зараженных растениях. Для ограничения роста фитоплазмы требуется температура 88°F в течение 10-12 дней.

Как ухаживать за желтой астрой

Это заболевание не лечится. Первое и самое важное, что нужно сделать, это удалить все зараженные растения из вашего сада и уничтожить все растительные остатки.Это не позволит им стать источником фитоплазмы для распространения цикадок.

Борьба с сорняками

Фитоплазма может пережить северные зимы в корнях и кронах зараженных многолетников, в том числе сорных растений.

Этот возбудитель может содержаться во многих сорняках, поэтому важно удалить их из сада, газона и прилегающих территорий.

Вам следует сосредоточиться на одуванчиках и подорожнике, поскольку они являются такими распространенными хозяевами.

Рассмотрите менее восприимчивые виды растений

Если в вашем саду постоянная проблема с желтизной астры, вы можете посадить альтернативные виды цветущих растений.

К растениям, невосприимчивым к этому заболеванию, относятся:

Борьба с насекомыми

Хотя удаление цикадок с вашего двора может показаться отличным решением, это может быть трудно сделать, если только вы не выращиваете восприимчивые растения в больших масштабах.

Салат, выращиваемый под плавающими укрытиями для борьбы с цикадками и другими вредителями. Фото через Shutterstock.

Если вы знаете, что у вас могут возникнуть проблемы, вы можете посадить такие культуры, как салат , под плавающими крышками для защиты от насекомых.

Еще один вариант, который используют некоторые фермеры, — прокладка полосок алюминиевой фольги между рядами. Это служит для того, чтобы сбить с толку цикад, которые с меньшей вероятностью приземлятся на ваши посевы.

Астровые цикадки оставляют после себя деформированные растения

Если вы не живете в очень жарком районе, ваши растения семейства астровых и сложноцветных уязвимы для коварной болезни астровой желтухи.

Однако болезнь не будет распространяться, если в вашем саду не гуляют цикадки, переносящие патоген.Если вы знаете, что они представляют собой проблему, вы можете принять меры для их предотвращения.

Эхинацея, пораженная болезнью желтухи астр. Фото через Алами.

Если у вас есть гротескно деформированные цветы, вам нужно будет быстро удалить эти растения из вашего сада, чтобы предотвратить распространение болезни.

Встречали ли вы в своем саду желтую астру? Удалось ли вам предотвратить его распространение? Дайте нам знать, как вы справились в комментариях.

И далее распространенные болезни и вредители садовых растений в том числе:

© Ask the Experts, LLC.ВСЕ ПРАВА ЗАЩИЩЕНЫ. См. наши TOS для более подробной информации.

Как определить, лечить и предотвращать желтизну астр

Название «желтая астра» вводит в заблуждение, потому что это заболевание может поражать не только астры, но и более 300 различных видов растений. Тезка болезни — цикадка астра, насекомое, распространяющее возбудителя желтухи астры. Плохая новость заключается в том, что если растение заражено, лечения не существует. Но есть несколько вещей, которые вы можете сделать, чтобы предотвратить распространение желтой астры.

Какие растения могут быть поражены

Представители семейства астровых ( Asteraceae ) чаще всего поражаются желтизной астр. К ним относятся астра, календула, хризантема, кореопсис, космос, маргаритка, гайлардия, бархатцы, эхинацея пурпурная и цинния. Но другие однолетние и многолетние растения из более чем 40 других семейств растений также могут заболеть.

К заболеванию восприимчивы цветы: анемон, дельфиниум, барвинок, петуния, львиный зев, вероника.Многие огородные культуры также могут быть заражены, включая брокколи, капусту, цветную капусту, морковь, салат, лук, картофель, тыкву, шпинат и помидоры, а также петрушку. Клубника также может получить желтую астру.

И хотя заражение сорняками — одуванчиком, лапчаткой, конским сорняком, амброзией, чертополохом, дикой морковью и диким салатом — может показаться не проблематичным, на самом деле это так, потому что желтая астра в сорняках распространяет ее дальше на желательные растения.

Ель / К. Дэйв

Симптомы желтой астры

В зависимости от вида растения симптомы желтухи астры различны.Общим, однако, является то, что все растение проявляет симптомы, потому что патоген, вызывающий заболевание, перемещается по растению от корней к цветам.

У зараженных растений вы заметите низкорослые и многочисленные странные вторичные побеги. Листья мельче и уже, чем на здоровом растении, закручены или скручены. На листьях проявляются признаки хлороза — листья желтеют, а жилки остаются зелеными. Листва бледная, желтоватая или белая, на более позднем этапе также красная или фиолетовая.

Цветки маленькие и неправильной формы, часто вместо цветков появляются причудливые листовые части. Эхинацея пурпурная может развить вторую собранную головку цветка, а бархатцы могут иметь лиственные цветы. Цветы бесцветные, зеленовато-тусклые, и далеко не их яркие цвета. Растения не производят семян, а если и производят, то семена стерильны.

У зараженной моркови на ботве имеется пучок красных или желтых чахлых листьев. Вместо здорового толстого корня имеется только тонкий стержневой корень с множеством маленьких белых опушенных корней.Они часто имеют горький вкус. Точно так же ботва лука скрученная и желтая, а листья превращаются в толстые чахлые пучки.

У салата явными признаками пожелтения астр являются скрученные и скрученные внутренние листья. Голова никогда полностью не развивается. На листьях также есть розовые или коричневые пятна.

Если у ваших садовых растений наблюдается пожелтение листьев, это не обязательно означает, что астра пожелтела, это также может быть повреждение гербицидами.

Ель / К. Дэйв

Как распространяется астра желтая

Чтобы справиться с желтухой астры, важно понимать, как распространяется возбудитель.Желтизна астр вызывается фитоплазмой, типом бактерий, которые могут жить только в жилках растения или внутри цикадки астровой ( Macrosteles quadrilineatus ).

Когда астровая цикадка питается растением, зараженным астровой желтухой, она вместе с соком растения всасывает часть фитоплазмы астровой желтухи. В течение примерно двух недель фитоплазма в теле цикадки вызывает инфекцию слюнных желез, и всякий раз, когда зараженная цикадка питается другими здоровыми растениями, она передает фитоплазму этому растению.Фитоплазма остается в цикадке в течение всей ее жизни, не причиняя вреда самому насекомому.

Цикадка астра не выживает в климате с минусовыми зимами. Весной астровые цикадки перемещаются на север от мест зимовки вдоль Мексиканского залива.

Возникновение желтухи астр напрямую связано с популяцией цикадки астр в любой данный год. Прохладное влажное лето создает благоприятные условия для цикадки, а значит, и для распространения болезни, тогда как в жаркую сухую погоду желтуха астр встречается реже.

Что делать, если растение заражено

После заражения растения астровой цикадкой симптомы появляются в течение 10–40 дней. Не существует лекарства, обработки, пестицидов или инсектицидов для борьбы с желтизной астр.

Вот почему ранняя диагностика имеет решающее значение. Немедленно удалите все зараженные растения из своего сада и утилизируйте их, чтобы цикадки больше не могли питаться ими и распространять болезнь дальше.

Возбудитель желтухи астры не выживет на мертвом растении, поэтому вы можете компостировать зараженные растения.

Как предотвратить распространение желтизны астр

Сложность с желтыми астрами заключается в том, что они не убивают растение. Поэтому, как садовник, вы можете оставить зараженное растение в своем саду, особенно если это многолетнее растение. Не делайте этого — патоген может выживать в многолетних растениях от одного сезона к другому, а инфицированные многолетники могут передавать желтизну астр другим растениям в течение многих лет. Все, что для этого требуется, — это цикадка, питающаяся этим растением.

По этой причине вы должны удалить все многолетники — ландшафтные растения, а также сорняки — из своего сада.

Механические барьеры также используются для защиты растений от цикадки астры, такие как светлая или светоотражающая мульча или фольга, чтобы дезориентировать насекомых, чтобы они не питались растениями. Овощи могут быть защищены плавающими крышками рядов, сетчатыми тканями или мелкой проволочной сеткой.

Посадка в саду только здоровых черенков и растений из надежного источника — первый шаг к предотвращению желтизны астр.

Если у вас есть желтые астры, рекомендуется выбрать растения, которые менее восприимчивы к болезни, такие как петушиный гребешок, герань, недотрога, никотия, шалфей или вербена.

Прополка, особенно подорожник (многолетний сорняк) и одуванчик, которые являются основными переносчиками возбудителя желтухи астры, также помогает контролировать болезнь.

Ель / К. Дэйв

Желтые астры — Growing A Greener World®

Цикадки являются наиболее распространенным источником «Желтых астр»

Недавно пришло электронное письмо с несколькими фотографиями. Это был простой вопрос: «Можете ли вы описать, что замышляет моя эхинацея (эхинацея пурпурная) и как предотвратить это в будущем»?

На фотографиях зафиксировано классическое проявление симптомов «желтых астр».Фиолетовые эхинацеи демонстрируют некоторые из наиболее ярких свидетельств этого несмертельного, но потенциально плодовитого заболевания. Вторичные цветочные головки, возникающие из первичных цветков, могут быть обычным явлением. Тем не менее, желтая астра — это болезнь, поражающая более 300 видов растений, включая травянистые декоративные растения, овощи и даже сорняки.

Зараженные растения могут служить отправной точкой для распространения на другие незараженные растения. Источником проблемы является бактериоподобный микроскопический организм, известный как фитоплазма.Чаще всего его распространяет крошечное насекомое, известное как цикадка. Поскольку цикадка питается зараженными растениями, она получает эту фитоплазму через сок растений. Попав внутрь тела насекомого, болезнетворные организмы быстро размножаются. В конце концов, фитоплазма снова появляется, когда цикадка питается здоровыми растениями.

Симптомы желтой астры развиваются быстрее всего и более выражены при теплой температуре. При более низких температурах растения могут быть заражены без каких-либо видимых признаков.Уникальные симптомы также различаются между типами растений. Симптомы, общие для большинства зараженных растений, включают желтую листву, замедленный рост, цветы, которые остаются на зеленой стороне, и общий искаженный вид.

Контролировать желтую астру непросто. Известного лекарства от этой болезни не существует, а химическая борьба с цикадкой-переносчиком обычно неэффективна и поэтому не рекомендуется. Лучшее средство борьбы с этой проблемой, как и со многими другими садовыми болезнями, — хорошая санитарная обработка. Немедленно удалите и уничтожьте все зараженные растения, которые увидите.Сюда входят все сорняки, поскольку они могут быть общим источником этого заболевания.

Наконец, не все растения восприимчивы к болезни. Большинство древесных кустарников, кажется, избегают этой проблемы, а также некоторые травянистые растения, такие как шалфей, герань и импатиенс. Выбор устойчивых растений и удаление зараженных растений — лучшие методы борьбы с желтыми астрами в домашнем ландшафте.

О Джо Лэмп’ле

Джо Лэмп’л — ведущий и исполнительный продюсер отмеченного наградами телесериала PBS «Растем, зеленее мир».Вне камеры Джо посвящает свое время продвижению устойчивого развития через свои популярные книги, блог, серию подкастов и общенациональные синдицированные газетные колонки. Подписывайтесь на Джо в Твиттере

Желтуха астр на цветках

Симптомы желтухи астр на гайлардии. Фото: Уитни Крэншоу, Университет штата Колорадо, Bugwood.org

Желтая астра вызывает общее пожелтение и остановку роста растения. Часто на более старых растениях наблюдаются другие симптомы, такие как колючие колючки, аномальное, массовое, кистевидное развитие множества слабых побегов, возникающих в одной и той же точке или рядом с ней, аномальное образование придаточных корней, уродливые цветки с лепестками, которые часто имеют аномально зеленый цвет. , увядание и отмирание.Это заболевание распространяется в поле Macrosteles fascifrons , цикадкой астровой. Желтая астра выживает во многих сорняках-хозяевах, а цикадки, питающиеся зараженными сорняками, могут распространять болезнь на здоровые сельскохозяйственные растения. Многолетники, зараженные желтухой астр, обычно погибают в течение первого сезона заражения.

Симптомы желтизны астр. Фото: University of Maryland

Желтизна астр вызывается фитоплазмами. Фитоплазмы представляют собой круглые или удлиненные организмы, похожие на бактерии, но лишенные клеточных стенок и принадлежащие к классу моллюсков.Ранее они были классифицированы как микоплазмы или MLO (микоплазмоподобные организмы). Фитоплазмы проникают во флоэму и вызывают симптомы болезни, иногда похожие на вирусы.

Наилучшие методы борьбы с фитоплазмами, такими как астра желтая, направлены на предотвращение интродукции в ландшафт. Раннее обнаружение инфекции имеет решающее значение для предотвращения гибели растений. Осмотрите новый растительный материал и укоренившиеся растения на предмет аномальной окраски, задержки роста. Отправьте образцы растений для тестирования и уничтожьте все зараженные растения.Лекарства от зараженных растений нет. Удалите зараженные растения, как только они будут диагностированы, чтобы предотвратить распространение на близлежащие здоровые растения. Борьба с сорняками очень важна, так как сорняки могут служить источником инфекций. Уничтожайте сорняки, такие как чертополох, дикий цикорий, дикая морковь, одуванчик, полевая маргаритка и широколистный подорожник, которые могут действовать как резервуары фитоплазм.

Астровая желтуха или эритроидный клещ? – Мастера-садовники Торонто

(Вопрос)

Привет, мастера-садоводы,
У меня есть 9 растений эхинацеи Green Twister, которые я посадил прошлой осенью.Все они поначалу росли просто отлично, цветы выглядели как нормальная эхинацея. Однако за последние пару месяцев или около того я заметил, что цветы на большинстве растений растут искаженными, с некоторыми зелеными и красными / зелеными ростками, прорастающими из центров конусов. Я срезала эти цветы, как только нашла их, думая, что это проблема эритроидного клеща (до сих пор я срезала МНОГИЕ появляющиеся цветы, так как почти все они проявляли эти симптомы). Тем не менее, в течение последних нескольких недель я оставлял цветы полностью формироваться, чтобы посмотреть, какие они получатся.Некоторые из них появились с лепестками, некоторые без, а некоторые с аномально маленькими, округлыми и зелеными лепестками, как вы можете видеть на фотографии, которую я представил. Листья на растениях кажутся нормальными зелеными, без пожелтения. У меня такой вопрос: есть ли у моих растений то ли астровые желтки, то ли эритроидные клещи (или что-то совсем другое?!), и что мне делать с лечением? Я не хочу удалять/уничтожать растения, но, очевидно, сделаю это, если вы сочтете это необходимым. Пожалуйста помоги!
Спасибо

(Ответить)

Благодарим вас за то, что обратились к Мастерам-садовникам Торонто с вопросом о ваших эхинацеях.

Эхинацея (эхинацея) — популярный садовый цветок. Они не только придают красивый цвет саду с лета до осени, они также являются отличным источником семян для перелетных птиц.

Несмотря на то, что эхинацею могут поражать и другие болезни, такие как японские жуки, тля и уховертки, есть две серьезные проблемы, которые поражают эхинацею: розеточный клещ эхинацеи и фитоплазменная болезнь, известная как желтая астра.

Розеточный клещ эхинацеи живет внутри развивающихся цветочных почек и высасывает питательные вещества из основания цветка, вызывая чахлость и деформацию частей цветка, например, отсутствие лепестков.

Желтая астра вызывается фитоплазмой. Эта небольшая специализированная бактерия, переносимая от растения к растению при помощи сосущих насекомых, заражает ткань флоэмы растения. Ткань флоэмы отвечает за проведение пищи, произведенной в результате фотосинтеза, от листьев ко всем другим частям растения. В результате симптомы пожелтения астр включают хлоротичную скручивающуюся листву; низкорослые стебли; и причудливо искаженные части цветка.

Поскольку общее состояние здоровья вашего растения, похоже, не пострадало, я полагаю, что ваш эхинацея поражена розеточным клещом эхинацеи.Осенью важно обрезать зараженные растения до земли и удалить все части растений с участка, чтобы предотвратить повторное заражение в следующем году. Также важно не компостировать эти части растений, а вместо этого поместить их в черный полиэтиленовый пакет и выбросить с мусором.

В Университете штата Огайо есть отличный информационный бюллетень под названием «Очистка эхинацеи», в котором показано влияние двух болезней на эхинацею.

Удачи с эхинацеей.

 

Желтуха астр – распространенная садовая болезнь

Breadcrumb Trail Links

  1. Садоводство

Если вы обнаружите в своем саду растение, которое имеет странный характер роста, вполне возможно, что оно заражено болезнью желтухи астры.

Высокие растения слева здоровы, инфицированные растения невысокие с зеленоватыми цветками. Предоставлено Джилл Томсон. Для садовой колонки Bridges 0802 Фото Jill Thomson /Saskatoon

Обзоры и рекомендации непредвзяты, продукты выбраны независимо. Postmedia может получать партнерскую комиссию от покупок, сделанных по ссылкам на этой странице.

Содержание статьи

Если вы нашли в своем саду растение со странным характером роста, вполне возможно, что оно заражено болезнью желтухи астры.Это заболевание было впервые выявлено на цветках астры много лет назад. Ответственным организмом является мельчайшая частица вирусоподобного генетического материала, называемая фитоплазмой, которая в основном передается цикадками. Когда цикадка питается зараженным растением, она всасывает частицы фитоплазмы, и ее слюнные железы «заражаются». Через 10-14 дней при питании здоровыми растениями цикадка впрыскивает во флоэму фитоплазму; симптомы болезни появятся у растения через 10-40 дней. От желтизны астр нет лекарства, и инфицированные растения следует удалять, поскольку они становятся резервуарами инфекции, способной увеличить количество присутствующих болезней.

Содержание статьи

Заболевание имеет чрезвычайно широкий круг хозяев, включая многие декоративные растения, такие как астра, дельфиниум, эхинацея, календула, цинния, хризантема, петуния и львиный зев. Овощи и травы, такие как салат, морковь, тыква, помидоры, сельдерей и кориандр, также могут быть инфицированы.

Симптомы заболевания могут сильно различаться в зависимости от растения-хозяина. Чаще всего растения становятся чахлыми и очень желтыми (хлоротичными). Иногда растения выше, чем обычно, и выделяются среди остальных здоровых растений, как это имеет место на полях рапса и кориандра.Другим очевидным признаком является то, что у цветов не развиваются нормальные лепестки. Вместо этого они обычно напоминают группу ненормальных, желтовато-зеленых, похожих на пузырь листьев. Это можно увидеть у дельфиниума, эхинацеи, календулы, рапса, астры и даже одуванчика.

Обратите внимание на бронзовые листья, густые стебли и тонкие густые боковые корни. Предоставлено Джилл Томсон. Фото Jill Thomson /Saskatoon

Морковь является обычным хозяином, если популяция цикад высока. Первым признаком заражения моркови является побурение листьев, за которым следует плотный рост мелких хлоротических листьев на верхушке моркови.Когда морковь выдернута, на основном корне моркови обычно образуется масса мелких корней, и морковь будет иметь горький вкус. Симптомы заболевания могут различаться в зависимости от того, какой вид заражен. Например, в то время как корни моркови могут быть горькими и волосатыми, салат может иметь розовые или коричневые пятна и скрученные внутренние листья. Около 12 лет назад была очень большая популяция цикадок, и в том же году пострадала тыквенная грядка в Университете Саскачевана. Зараженные растения тыквы сильно хлоротичны, листья имеют неправильную форму, а цветы не развиваются.Очевидно, это серьезно сказалось на урожайности, поскольку ни одно из зараженных растений не могло давать тыквы.

Содержание артикула

Обратите внимание на большие хлоротичные листья и более мелкие листья неправильной формы. Предоставлено Джилл Томсон. Фото Jill Thomson/Saskatoon

Иногда подобные симптомы могут быть вызваны заражением другими вирусами или случайным воздействием гербицида. В последнем случае растения иногда выздоравливают и симптомы исчезают. Этого не происходит при заражении астральной желтухой.

Стратегии борьбы с болезнью включают:

  1. Удаление изолированных образцов зараженных растений. Ранняя диагностика и своевременное удаление зараженных образцов помогают уменьшить распространение болезни. Кроме того, зараженные овощи можно собирать раньше, чтобы уменьшить резервуар инфекции.
  2. Уменьшить количество цикад. Однако это может быть сложно. Накрытие восприимчивых культур или отдельных растений мелкоячеистой тканью эффективно для защиты растений от цикад.
  3. Удаляйте сорняки, которые могут стать ранним источником инфекции при кормлении цикадками. Одуванчики могут пережить наши зимы, даже будучи зараженными. Цикадки, кормящиеся весной, могут подхватить от них фитоплазму и передать ее здоровым садовым растениям.
  4. Высаживайте менее восприимчивые виды, такие как герань, недотрога, никотиана, шалфей и вербена. Это полезно, если у вас возникли трудности с заражением астр желтизной на клумбе.

Джилл Томсон — специалист по болезням растений (на пенсии), которая занимается садоводством в Саскатуне со своей семьей, включая собак.

Эта колонка предоставлена ​​Саскачеванским многолетним обществом (SPS; [email protected] ). Посетите наш веб-сайт ( www.saskperennial.ca ) или страницу в Facebook ( www.facebook.com/saskperennial ), чтобы узнать о предстоящих мероприятиях по садоводству: Друзья лесной фермы — Историческая пешеходная экскурсия Лесной фермы , 25 августа 2019 г., 14:00. Встреча в резиденции управляющего.Бесплатно и открыто для публики – Небольшое пожертвование на угощение – 2,00 доллара США за парковку

Выживание и размножение цикадок астр и передача желтой астры при статических и меняющихся температурах с использованием ddPCR для количественного определения фитоплазмы

, 1 , 2 , 2 , 2 и 2

Md H. Bahar

1 Центр исследований и разработок в Шарлоттауне, Министерство сельского хозяйства и агропродовольственной промышленности Канады, 440 University Avenue, Charlottetown, PE C1A 004 90 4N6 Canada 90 4N6 CanadaWist

2 Исследовательский центр Саскатуна, Министерство сельского хозяйства и продовольствия Канады, 7 Science Place, Saskatoon, Saskatchewan S7N 0X2 Канада

Диана Р. Беккауи

2 Исследовательский центр Саскатуна, Канада Science Place, Saskatoon, Saskatchewan S7N 0X2 Canada

Dwayne D. Hegedus

2 Saskatoon Research Center, Agriculture and Agri-Food Canada, 7 Science Place, Saskatoon, Saskatchewan S7N 0X2 Canada

Chrystel Y.Olivier

2 Исследовательский центр Саскатуна, Министерство сельского хозяйства и продовольствия Канады, 7 Science Place, Saskatoon, Saskatchewan S7N 0X2 Канада

1 Центр исследований и разработок в Шарлоттауне, Министерство сельского хозяйства и продовольствия Канады, 440 University Avenue, Charlottetown , PE C1A 4N6 Канада

2 Исследовательский центр Саскатуна, Министерство сельского хозяйства и продовольствия Канады, 7 Science Place, Саскатун, Саскачеван S7N 0X2 Канада

Автор, ответственный за переписку.

Поступила в редакцию 16 августа 2017 г .; Принято 12 декабря 2017 г.

Открытый доступ Эта статья находится под лицензией Creative Commons Attribution 4.0 International License, которая разрешает использование, совместное использование, адаптацию, распространение и воспроизведение на любом носителе или в любом формате при условии, что вы укажете автора(ов) оригинала и источник, предоставьте ссылку на лицензию Creative Commons и укажите, были ли внесены изменения. Изображения или другие сторонние материалы в этой статье включены в лицензию Creative Commons для статьи, если иное не указано в кредитной строке материала.Если материал не включен в лицензию Creative Commons статьи, а ваше предполагаемое использование не разрешено законом или выходит за рамки разрешенного использования, вам необходимо получить разрешение непосредственно от правообладателя. Чтобы просмотреть копию этой лицензии, посетите http://creativecommons.org/licenses/by/4.0/.Эта статья цитировалась в других статьях PMC.

Abstract

Желтуха астр (AY) является важным заболеванием культур Brassica и вызывается Candidatus Phytoplasma asteris и передается насекомым-переносчиком, астровой листоверткой ( Macrosteles quadrilineatus ).Инфицированных фитоплазмой цикадок астр инкубировали при различных постоянных и флуктуирующих температурах от 0 до 35 °С с репродуктивным растением-хозяином ячменем ( Hordium vulgare ). При 0 °C имаго цикадки выживали в течение 18 дней, но не размножались, тогда как при 35 °C насекомые погибали в течение 18 дней, но успешно размножались перед смертью. Колебания температуры повышали термоустойчивость цикадок при 25 °С и увеличивали плодовитость цикадок при 5 и 20 °С. Взрослые особи цикадки успешно инфицировали и продуцировали AY-симптомы у растений канолы после инкубации в течение 18 дней при 0–20 °C на ячмене, что указывает на то, что AY-фитоплазма сохраняет свою вирулентность в этом диапазоне температур.Наличие и количество AY-фитоплазм у насекомых и растений подтверждали количественным определением капельной цифровой ПЦР (ддПЦР). Количество фитоплазм у цикад увеличивалось со временем, но не различалось в зависимости от температуры. Температуры, связанные с типичным периодом выращивания сельскохозяйственных культур в канадских прериях, не ограничат распространение болезни AY из-за преобладающего насекомого-переносчика. Кроме того, количественная оценка ddPCR является полезным инструментом для раннего обнаружения и точного количественного определения фитоплазмы в растениях и насекомых.

Введение

Болезнь желтых астр (AY) у Brassica и многих других сельскохозяйственных культур в Северной Америке привлекла значительное внимание из-за ее значительного негативного экономического воздействия на сельское хозяйство. AY вызывается фитоплазмой таксона « Candidatus Phytoplasma asteris» 1 , которая представляет собой бактерию без клеточной стенки, передающуюся в основном цикадками, питающимися флоэмой 2 . В то время как известно более 20 видов цикадок, распространяющих фитоплазменные заболевания, цикадка астра, Macrosteles quadrilineatus Forbes (Hemiptera: Cicadellidae), является основным переносчиком AY-phytoplasma в культурах Brassica 3 5 .

Глобальное изменение климата повлияет на такие биологические параметры, как физиология, биология и поведение насекомых, патогенов и растений 6 . Например, распространение многих насекомых и патогенов смещается к полюсам Земли 7 . Кроме того, повышение температуры может увеличить вероятность появления новых переносчиков фитоплазменных болезней 8 . Для прогнозирования будущих эпидемиологических характеристик и распространения AY-фитоплазмы вместе с ее насекомыми-переносчиками и растениями-хозяевами решающее значение имеют подробные исследования воздействия переменных температур на всю систему болезней.Однако влиянию переменных температур на эпидемиологию фитоплазмы уделялось мало внимания. В нескольких исследованиях тепловое воздействие на фитоплазму, насекомых-переносчиков и растения оценивалось отдельно, но они имеют ряд ограничений. Влияние температуры на передачу ‘ Ca . Phytoplasma asteris на Macrosteles quadripunctulatus Kirschbaum исследовали только при четырех постоянных температурах 9 , в то время как в другом исследовании использовались две постоянные температуры, чтобы сообщить, что кинетика размножения Flavescence doree удвоилась при 25 °C по сравнению с 20 °C 10 .Тем не менее, эксперименты, включающие постепенные изменения температуры, более экологически значимы, чем те, в которых используется постоянная температура, и гарантируют, что изучаемые виды имеют время для проявления своих физиологических механизмов адаптации 11 .

Исследования при постоянных экстремальных температурах по сравнению с колебаниями температуры показали различия в температурных пределах насекомых 12 , 13 . Изменчивая окружающая среда может привести к другим естественным закономерностям, чем те, которые очевидны при средних условиях окружающей среды, предсказанных теорией неравенства Дженсена 14 .Закопченная медная бабочка Lycaena tityrus (Lepidoptera: Lycaenidae) развивается быстрее при колебаниях температуры, чем при постоянной температуре 15 . Кроме того, время развития ромбовидной бабочки Plutella xylostella (Lepidoptera: Plutellidae) соответствовало той же схеме: более короткое время развития при температурах, которые колеблются около среднего значения (0–14 °C), чем при постоянном среднем значении 7 °C. С 13 . Эксперименты с колеблющейся, а не постоянной температурой могут быть более точным способом оценки влияния температуры на биологию насекомых или патогенов 16 .Еще одним потенциальным ограничением других исследований является изучение одного организма вместо комплекса организмов, вовлеченных в эпидемиологию заболевания. Паразиты и их хозяева часто существуют в сбалансированном равновесии плотности популяции, и эпидемиология их болезней также может находиться в равновесии 17 , 18 . При условии, что синхронность развития паразита и его хозяина зависит от температуры, изменение температуры может быть более полезным для одного вида, чем для другого.Следовательно, на синхронность между фитоплазмами и их появлением у насекомых-переносчиков могут влиять климатические факторы 19 . В других исследованиях изучалось влияние температуры на фитоплазму и ее растение-хозяин 11 , а также на фитоплазму и ее насекомое-переносчик 19 ; однако ни в одном исследовании не изучалось термическое воздействие на всю систему болезней, включающую фитоплазму, цикадку и растение-хозяин.

Различные методы, включая ИФА, ПЦР и ОТ-кПЦР, используются для количественного определения и мониторинга распределения и перемещения фитоплазм в растениях 20 22 .Метод капельной цифровой ПЦР (ddPCR) все шире используется для количественного определения микроорганизмов путем определения количества специфических генетических маркеров 23 27 . По сравнению с другими методами ПЦР ddPCR обеспечивает преимущества в динамическом диапазоне, включая обнаружение очень низкой концентрации молекул-мишеней в образце, при сниженной стоимости образца 28 , 29 . В отличие от аналоговой количественной ПЦР (кПЦР), где для оценки целевой концентрации используется стандартная кривая, ddPCR представляет собой подход к конечной точке и абсолютному измерению, с помощью которого можно определить количество копий мишени с использованием распределения Пуассона 29 .Между прочим, ddPCR более чувствительна, чем qPCR, для обнаружения редких молекул-мишеней и более точна при низком числе копий мишени 23 . Использование ddPCR в качестве инструмента для количественного определения фитоплазмы было подтверждено Mehle et al . 30 , который провел количественную оценку фитоплазмы Flavescence dorée в виноградной лозе путем оценки количества фитоплазмы на мкл ДНК. Перес-Лопес и др. . 31 также использовали ddPCR для количественного определения фитоплазм в ягодах и растениях барвинка.Однако в этих исследованиях не использовались анализы внутреннего контроля. Нет исследований по количественному определению фитоплазм в насекомом-переносчике с использованием ddPCR.

Цели данного исследования заключались в изучении: (1) выживания и размножения AY-фитоплазмы; (2) выживаемость, размножение и способность передавать болезни насекомого-переносчика M. quadrilineatus и (3) выживаемость его растительной пищи и репродуктивного хозяина, ячменя ( Hordeum vulgare L) (Poaceae) в диапазоне постоянных и переменные температуры, которые имитировали естественный климат с использованием уникального массива ячеек температурного градиента.Количество AY-фитоплазмы, присутствующей в растениях и насекомых, было количественно определено с использованием ddPCR, позволяющей проводить абсолютную количественную оценку 23 .

Результаты

Для оценки влияния температуры инфицированные AY-фитоплазмой и здоровые цикадки на растения ячменя инкубировали при различных постоянных (0, 5, 10, 15, 20, 25, 30 и 35 °C) и флуктуирующих температурах ( 0–10 °C со средним значением 5 °C, 15–25 °C со средним значением 20 °C, 20–30 °C со средним значением 25 °C и 25–35 °C со средним значением 30 °С) в отдельных ячейках системы температурного градиента.В этом разделе представлены выживаемость и размножение цикадки, а также количество фитоплазм у насекомых и растений.

Влияние температуры на выживаемость цикадок

Было отмечено значительное влияние ( P  < 0,001) температуры на выживаемость цикад к 7 -му дню, но AY-инфекция не влияла на выживаемость цикад ( P  = 0,10), без значимого взаимодействия между AY-инфекцией и временем ( P  = 0,12).Аналогично, на 14 -й день не было выявлено достоверного взаимодействия между AY-инфекцией и временем ( P  = 0,10) и влияния AY на выживаемость цикад ( P  = 0,50), но наблюдалось значительное влияние ( P  < 0,001) температуры на выживаемость цикад. Эта тенденция сохранялась до 18 -го -го дня без значимого взаимодействия между AY-инфекцией и временем ( P  = 0,10), а также без влияния AY-инфекции на выживаемость ( P  = 0.50), но значительное влияние ( P  < 0,001) температуры на выживаемость цикад (таблица). Во все три дня отбора проб самые высокие проценты выживших цикадок были обнаружены в анализах, проводившихся при постоянной температуре 5, 10, 15, 20 °C и при колебаниях температуры от 5 до 20 °C. Через 18 дней ни одна цикадка не выжила при постоянной температуре 35 °C или колеблющейся температуре со средним значением 30 °C (таблица). В целом колебания температуры не оказали существенного влияния (7 й день P  = 0.88; 14 день P  = 0,92; 18 сут P  = 0,96) на выживаемость цикад, за исключением 25 °С на 14 и 18 сут, где при флуктуирующем температурном режиме выживало значительно больше цикад, чем при постоянном режим (таблица).

Таблица 1

Процент выживших взрослых особей цикадки, инфицированных AY-фитоплазмой (AY + LH) или неинфицированных (AY − LH) после 7, 14 и 18 дней инкубации при различных температурах.

98.3 ± 6.0a

Эффект температуры на репродукции Reasthopper

Некоторые взрослые листогипы выжили при постоянной температуре 0 ° C , но не размножались, так как на растениях ячменя не было обнаружено ни яиц, ни нимф.При температуре 35 °C через 18 дней не выжили имаго, но яйца и нимфы цикадки наблюдались на 70% растений ячменя. При постоянных температурах 5, 10, 15 и 20 °С яйца встречались на 60–100% растений ячменя, но личинок наблюдалось очень мало (рис. ). Колебания температуры оказали заметное влияние на производство яиц и нимф при 5, 20 и 30 °C. У большего количества растений были яйца при постоянной температуре, тогда как у большего количества растений были нимфы при колебаниях температуры в среднем 5 и 20 °C. Меньшее количество растений имело яйца и нимфы при колеблющейся температуре со средним значением 30 °C, чем при постоянной температуре 30 °C (рис.).

Доля растений ячменя (N = 8 на температурную обработку) с яйцами или нимфами цикадки астровой после 18 дней инкубации при различных постоянных (Const) и колеблющихся (Fluc) температурах (°C).

Обнаружение AY-фитоплазмы в растениях ячменя

Растения ячменя, зараженные AY-инфицированными или неинфицированными цикадками, выживали при всех температурах, кроме 35 °C; однако фитоплазмы не были обнаружены ни на одном из растений ячменя.

Обнаружение и количественная оценка AY-фитоплазмы у цикадки астровой

Взаимодействия не было ( P  = 0.25) между временем, колебаниями температуры и температурой на среднее количество фитоплазм, присутствующих в одной цикадке. Наблюдалось значительное увеличение количества AY-фитоплазм у цикад через две недели инкубации по сравнению с одной неделей инкубации ( P  = 0,005). Однако различий в количестве фитоплазм между температурами не было ( P  = 0,96) (рис. ).

Среднее количество фитоплазмы (±SE), присутствующее в каждой взрослой цикадке после инкубации при различных постоянных (Const) и флуктуирующих (Fluc) температурах в течение одной и двух недель, количественно определено с помощью ddPCR.

AY-фитоплазма в растениях канолы

Через 18 дней инкубации выжившие взрослые цикадки, инфицированные AY, были извлечены из камер биоанализа при постоянной температуре от 0 до 20 °C, а также при колебаниях температуры со средним значением 5 °C , были перенесены на здоровых растений B. napus . Через шесть недель у всех растений проявились симптомы, типичные для болезни AY (рис. ). Присутствие AY-фитоплазмы в этих растениях было подтверждено с помощью ddPCR. Существенных различий не было ( P  = 0.47) по количеству фитоплазм в растениях, зараженных цикадками при инкубации при различных температурах (рис. ).

Типичные симптомы пожелтения астр, наблюдаемые у растений канолы ( Brassica napus сорта AC Excel) по сравнению со здоровым зрелым растением. Растения заражали AY-фитоплазмоносителями цикадками астр, которых инкубировали в течение 18 сут при различных температурах.

Среднее количество фитоплазм (±SE), присутствующих в геномной ДНК растений канолы ( Brassica napus cv.АС Эксель). Растения заражали AY-цикадками, которых инкубировали при пяти постоянных (Const) и одной колеблющейся (Fluc) температурах.

Обсуждение

В этом исследовании мы использовали диапазон постоянных и флуктуирующих температур, с которыми возбудитель желтухи астр, AY-фитоплазма, переносчик, цикадка астра, M. quadrilineatus , и его растения-хозяева будут сталкиваться во время типичный вегетационный период в канадских прериях 32 . Это исследование представляет собой первое использование ddPCR для количественного определения количества AY-фитоплазмы в растениях ( B.napus и H. vulgare ), а также в насекомом-переносчике M. quadrilineatus . В дополнение к обнаружению фитоплазмы анализ ddPCR позволяет проводить абсолютную количественную оценку количества AY-фитоплазмы в отдельном образце цикадки и в растениях. Эта количественная информация имеет решающее значение для определения титра AY-фитоплазмы на цикадку, что означает способность передавать фитоплазму растениям. Поскольку здесь доказано, что праймеры/зонды ddPCR B. napus функционируют, также возможно абсолютное количественное определение AY-фитоплазмы из образцов растений канолы.Эта информация поможет определить, в какой степени развитие AY-симптома у канолы связано с AY-фитоплазмой, присутствующей в пораженных тканях растения. Это позволит прогнозировать симптомы AY и влияние на урожайность. Представленные здесь результаты позволили оценить репликацию AY-фитоплазмы как у цикадки астровой, так и у двух растений-хозяев с течением времени и в широком диапазоне постоянных и колеблющихся температур.

Температура оказала значительное влияние на выживаемость взрослых цикад и на их репродуктивную способность.Очень немногие цикадки выживали при температуре ≥30 °C, в то время как 20% цикадок выживали при 0 °C в течение 18 дней. Это указывает на то, что верхний температурный предел выживания цикадок астр составляет примерно 30 °C. Предварительный эксперимент также показал, что цикадки Aster могут выдерживать отрицательные температуры; однако в этом исследовании нижний температурный предел для цикадки Aster не оценивался. Жизнеспособные яйца, из которых впоследствии вылупились нимфы, наблюдали на растениях ячменя, выращенных при постоянной температуре 35 °С, а не при 0 °С.Большее количество яиц наблюдалось на растениях, выращенных при постоянной температуре 5, 10, 15, 20 или 25 °С, по сравнению с ≥30 °С. Таким образом, наиболее подходящий температурный диапазон для выживания и размножения астровой цикадки составляет от 5 до 20 °С. Интересно, что цикадка астра способна откладывать жизнеспособные яйца даже при 5 °C, в отличие от картофельной цикадки, Empoasca fabae (Harris), другой цикадки, мигрирующей в Западную Канаду, которая не откладывает яйца при температуре ниже 9 °C 33 .

Тенденция к лучшей приспособленности наблюдалась при колебаниях температуры по сравнению с постоянной температурой. Например, частота вылупления яиц увеличивалась при колебаниях температуры со средним значением 5 и 20 °C по сравнению с постоянными температурами 5 и 20 °C. При постоянной температуре 30 °C все растения имели яйца и нимфы, но при колебаниях температуры около 30 °C доля растений с яйцами и нимфами уменьшалась, что свидетельствует о том, что верхняя термостойкость для размножения цикадки астр находится между 31 и 35 °. С.Текущее исследование также показало, что яйца цикадки начинают вылупляться в течение 18 дней при температуре 20 °C и выше, что согласуется с выводами Falzoi et al . 34 , который сообщил, что оптимальная температура для вылупления яиц американской цикадки Scaphoideus titanus (Hemiptera: Cicadellidae) составляет 22 °C.

Температура значительно повлияла на выживаемость цикадки, но не на репликацию AY-фитоплазмы в цикадке.Во все три дня отбора проб самый высокий процент выживших цикадок был обнаружен в анализах, проводившихся при постоянной и колеблющейся температуре от 5 до 20 °C. Отмечена тенденция увеличения численности AY-фитоплазм у цикадки при постоянной температуре 5 °С и колебаниях температуры в районе 5 и 20 °С. В этом исследовании на выживаемость цикадки не повлияла инфекция AY-phytoplasma. Напротив, Beanland 35 сообщил, что самки цикадки жили дольше (28 дней) на растениях, зараженных AY-фитоплазмой, чем на неинфицированных растениях (19 дней).Взаимодействие между температурой и инфекцией AY-фитоплазмы цикад может повлиять на выживаемость. В других исследованиях выживаемость инфицированных и неинфицированных цикадок не различалась при постоянных температурах 15 и 20 °C, но наблюдалось значительное увеличение выживаемости инфицированных цикад по сравнению с неинфицированными цикадками при 25 и 30 °C 36 . Однако при заражении фитоплазмой Chrysanthemum yellows 37 M. quadripunctulatus произошло обратное явление.Талли и др. . 38 сообщалось, что большинство известных микоплазм не выживали при температуре выше 34 °C, но текущее исследование обнаружило фитоплазму в телах мертвых цикад, инкубированных при 35 °C. К сожалению, гибель цикадок при этой температуре не позволила перенести цикадок на растения B. napus , чтобы определить, активна ли еще фитоплазма. Учитывая все параметры жизненного цикла, измеренные в этом исследовании, диапазон температур 5–20 °C был наиболее подходящим для цикадок астр, и всякий раз, когда цикадки выживали, они успешно передавали AY-фитоплазму здоровым растениям.В этом диапазоне инфицированные цикадки отложили больше яиц, и больше яиц вылупилось при более высоких температурах. У S. titanus повышение зимней температуры вызывает асинхронность между вылуплением яиц и распусканием почек виноградной лозы ( Vitis vinifera ), показывая, что более высокие температуры, вплоть до критической точки, ускоряют вылупление яиц 19 .

Эффективность передачи в зависимости от температуры является общим признаком многих трансмиссивных болезней 39 .В текущем исследовании цикадки смогли передать AY-фитоплазму здоровым растениям B. napus и вызвать симптомы AY-болезни при всех температурах, которые позволяли цикадкам выживать. Таким образом, насекомое-хозяин и фитоплазма имели одинаковый уровень приспособленности и температурной устойчивости в испытанных условиях окружающей среды. Аналогично, Galetto и др. . 40 установлено, что условия окружающей среды влияют на размножение фитоплазмы и что этот эффект зависит как от растения-хозяина, так и от насекомого-хозяина.В текущем исследовании потенциальная способность цикад к передаче болезней не могла быть определена при трех экстремальных температурах (0, 30, 35 °C), поскольку выжило слишком мало цикад, чтобы их можно было передать B. napus . Рекомендуются дальнейшие исследования, которые начинаются с большего количества цикадок или сокращения продолжительности инкубации, чтобы обеспечить выживание достаточного количества цикадок для переноса на растения. В предварительном эксперименте взрослые цикадки M. quadrilineatus могли выживать в течение одной недели при температуре до –4 °C; следовательно, необходимы дальнейшие исследования при более низких экстремальных температурах для выяснения нижнего порога передачи AY-фитоплазмы этой цикадкой.

Сочетание подходящей температуры и направления ветра привело к появлению цикад и AY в канадских прериях 41 . Урожай также должен находиться на стадии роста, восприимчивой к инфицированным мигрирующим цикадкам, чтобы нанести экономический ущерб в результате заражения AY-фитоплазмой 42 . Температура может быть неблагоприятной для укоренения цикад в годы с продолжительной зимой и запоздалой весной в прериях. Если цикадки прилетают с ранними южными ветрами в неблагоприятных условиях, они не смогут выжить или размножаться и, следовательно, не будут передавать AY-фитоплазму.Эта ситуация является разумным объяснением возникновения только случайных вспышек AY на восприимчивых культурах в канадских прериях 43 . Информация, содержащаяся в этом исследовании, расширяет наше понимание эпидемиологии болезни желтой астры. Долгая зима с задержкой весны может снизить вероятность вспышек AY в этот вегетационный период. Точно так же резкое снижение выживаемости цикад при высоких температурах может привести к уменьшению распространения AY-фитоплазмы в конце вегетационного периода в условиях экстремальной жары.При более высоких температурах, даже если цикадки размножаются перед смертью, их потомство может не пережить латентный период амплификации AY-фитоплазмы, необходимый для того, чтобы цикадки стали эффективными переносчиками. Тем не менее, обычный температурный диапазон типичного вегетационного периода в канадских прериях не ограничивает передачу AY-фитоплазмы через насекомое-переносчик, цикадку астру.

Материалы и методы

Фитоплазма, насекомые-переносчики и растения-хозяева

AY-фитоплазма (’ Ca .Штамм P. asteris 16SrI-B) был получен из установленной культуры в Исследовательском центре Саскатуна Министерства сельского хозяйства и продовольствия Канады, поддерживаемой в колонии с ее переносчиком, астровой цикадкой, M. quadrilineatus , на растениях ячменя и барвинка. ( Vinca minor L. (Apocynaeae)) содержали в клетках BugDorm 1 (Megaview Scientific). Колонию цикадки, инфицированную AY, содержали в клетках BugDorm на растениях ячменя (репродуктивный хозяин) с барвинком, выступающим в качестве растения-хозяина для AY-фитоплазмы, в ростовых камерах (Conviron) при 24 ± 1 °C, с 16 h L: 8-часовой фоторежим D и приблизительно 55% относительной влажности.Колонию, не инфицированную AY, содержали в тех же условиях окружающей среды, но только на растениях ячменя. Раз в два месяца проводились ПЦР-тесты, чтобы гарантировать, что 100% растений барвинка раковины AY и 95–100% взрослых цикадок были инфицированы AY-фитоплазмой, а неинфицированная колония цикадок оставалась свободной от AY-фитоплазмы.

Растения ячменя, барвинка и канолы ( Brassica napus L. cv. AC Excel) выращивали в ростовой камере (температура: 20 ± 1 °C, 16 ч L: 8 ч D фоторежим) в 15-см пластмассовые горшки диаметра, содержащие беспочвенную смесь (модифицированную по Stringham 44 ).Было добавлено гранулированное удобрение с медленным высвобождением (26:13:0) (2  г/л) и почва поливалась ежедневно до прорастания семян и по мере необходимости впоследствии. Для растений B. napus первоначально высаживали 3–5 семян, и в каждом горшке давали возможность расти самому здоровому сеянцу.

Схема эксперимента

Каждая повторность состояла из 10 растений ячменя в пластиковом стакане объемом 35 мл с 30 мл беспочвенной среды для выращивания 44 . Через пять дней после прорастания каждую чашку помещали в пластиковую прозрачную пластиковую чашку объемом 370 мл, и в каждую пластиковую чашку добавляли 20,5-дневных инфицированных AY взрослых цикадок, собранных из клетки для колонии с помощью аспиратора с батарейным питанием (рис. .). Растения и насекомые инкубировались при восьми различных постоянных температурах (0, 5, 10, 15, 20, 25, 30 и 35 °С) и четырех флуктуирующих температурах (0–10 °С со средним значением 5 °С, 15–15°С). 25°C при средней температуре 20°C, 20–30°C при средней температуре 25°C и 25–35°C при средней температуре 30°C) на термоградиентной пластине 45 . Фаза более высоких колебаний температуры соответствовала 12-часовому световому периоду, а более низкие колебания температуры — 12-часовому периоду темноты. Циклы колебаний температуры были скорректированы для постепенного увеличения или уменьшения на 0.5–2,0 °С/ч. Пластина с температурным градиентом содержала 98 отдельных ячеек для биоанализа (10,5 см в диаметре и 12,0 см в глубину), причем температура в каждой ячейке контролировалась независимо компьютером. Температуру отдельных ячеек контролировали с помощью термопары, и температура постоянно находилась в пределах  ± 0,2 °C от заданной температуры. Каждая камера была снабжена стеклянным колпаком, через который проникал свет. Свет с интенсивностью около 110 мкмоль м -2 с -1 обеспечивали флуоресцентные трубки, подвешенные на высоте 1 м над клетками.Для каждого температурного режима было по пять повторностей с AY-инфицированной цикадкой. Три контрольных повтора были выполнены одновременно по тому же протоколу с неинфицированными AY цикадками, то есть цикадками, выращенными в отдельной камере для выращивания на здоровых растениях ячменя. Количество выживших цикадок регистрировали через 7, 14 и 18 дней инкубации. На 7 й и 14 день по три цикадки из каждой повторности были собраны и заморожены в жидком азоте для анализа ДНК для количественного определения количества AY-фитоплазм в каждый момент времени.Растения ячменя тщательно исследовали на наличие яиц или нимф цикадки и взяли 100 мг ткани растения ячменя для количественного определения количества AY-фитоплазмы. Каждое растение подсчитывали биномиально как 1 или 0 по наличию или отсутствию яиц или нимф, а долю растений с яйцами или нимфами рассчитывали на основе общего числа наблюдаемых растений.

Экспериментальная единица, которая использовалась как целостная система болезней, включающая AY-фитоплазму, насекомое-переносчик (цикадка астра) и растение-хозяин (ячмень).

На 18-й -й день цикадки, выжившие после каждой температуры, были перенесены на три однонедельных растения B. napus (стадия семядолей), содержащихся в сетчатой ​​клетке (BugDorm, Megaview Scientific) и оставлены для питания на 48 ч перед удалением. Растения содержали в вегетационной камере (Конвирон, модель ПГВ 35) при 20 °С, относительной влажности 50–60 %, 16 ч л: 8 ч Д фоторежима и 700–800 мкмоль м –2 с –1 интенсивность света в течение шести недель, чтобы обеспечить проявление AY-симптома 42 .Было зарегистрировано растения B. napus , экспрессирующих симптомы AY, и было собрано 100 мг ткани черешка листа каждого растения для количественного определения количества AY-фитоплазмы.

Количественное определение ДНК фитоплазмы с помощью ddPCR

ДНК экстрагировали из 100  мг лиофилизированной B. napus или ткани растения ячменя с использованием набора Plant Mini Kit (QIAGEN). ДНК из отдельных цикад, собранных на 7-й и 14-й день после заражения, экстрагировали с использованием набора Blood and Tissue Kit (QIAGEN).Приблизительно 200 нг ДНК расщепляли с помощью Eco RI (Invitrogen) в общем объеме 20 мкл. ddPCR использовали для количественного определения ДНК AY в растении или в насекомом-хозяине. Ген рРНК phytoplasma 16S амплифицировали из ДНК фитоплазмы с использованием ДНК-полимеразы 2X KAPA HiFi и праймеров R16F2 (5′-GAAACGACTGCTAAGACTGG-3′) и R16R2 (5′-TGACGGGCGGTGTGTACAAACCCC-3′) на основе последовательности GenBank (Access { «type»:»entrez-нуклеотид»,»attrs»:{«текст»:»DQ411470.1″,»term_id»:»89276410″,»term_text»:»DQ411470.1″}}DQ411470.1). Продукт ПЦР клонировали в pCR TM II-Blunt-TOPO (Invitrogen TOPO® DNA Cloning, Life Technologies Inc.) и секвенировали несколько клонов. Актин-2 B. napus Ген (GenBank Accession {«type»:»entrez-нуклеотид»,»attrs»:{«text»:»FJ529167.1″,»term_id»:»241740071″,»term_text»:»FJ529167.1″}} FJ529167.1) использовали в качестве эталона для подсчета количества AY-фитоплазмы по сравнению с эквивалентами генома растения. Праймеры и зонды ddPCR для фитоплазмы 16S рРНК и B.napus actin-2 были разработаны с использованием программного обеспечения PrimerQuest (Integrated DNA Technologies, Inc.) в соответствии с рекомендациями MIQE 46 (таблица). Фитоплазму цикадки количественно определяли с использованием праймера и зонда для 16S рРНК и рассчитывали как количество копий фитоплазмы на цикадку.

Таблица 2

Праймеры и зонды, разработанные и используемые в капельной цифровой ПЦР.

Инфекционный статус Leafhopers (LH) Выжившие (% ± SE) LH Взрослые после 7, 14 и 18 дней инкубации при различных температурах
Const 0 ° C Const 5 ° C Const 10 ° C const 15 ° C const 20 ° C const 25 ° C const 30 ° C Const 35 ° C Fluc 5 ° C Fluc 20 ° C Fluc 25 °C Fluc 30 °C
Через 7 дней
AY + LH 42 ± 3.4b 67 ± 6.0a 71 ± 60650 71 ± 6,8A 77 ± 4,4a 63 ± 69a 39 ± 9,7bc 35 ± 4,2 ° 3 ± 3.0d 71 ± 7.5a 56 ± 6.0ab 46 ± 2.9b 27 ± 7,5 ° С
AY — LH 43,3 ± 6.7B 73,3 ± 7,3A 75 ± 5,8A 60 ± 18.0A 60 ± 7,6a 8,3 ± 8,3d 28,3 ± 3,3c 6,7 ± 6,7d 85 ± 2.9a 51,7 ± 8.3ab 23,3 ± 11.7C 23,3 ± 6.7C
Через 14 дней
AY + LH 20 ± 52 ± 4.6A 35 ± 3.16 33 ± 6650 33 ± 6.4A 27 ± 11.0ab 5 ± 5,0C 9 ± 2,4 ° C 0 ± 0d 53 ± 9,0а 17 ± 8 мл 13 ± 7,0б 7 ± 3,0c
AY − LH 36,7 ± 4,4c 53.3 ± 1,7B 41,7 ± 10,9 млрд. 33,3 ± 9.200 10 ± 10de 0 ± 0f 0,3 ± 1,6e 3,3 ± 1,6e 70 ± 7,6а 15 ± 2,9д. 6.7 ± 3.0e 6.7 ± 3.0e 5 ± 5.0D
Через 18 дней AY + LH 12 ± 5.1b 12 ± 4A 18 ± 4AB 7 ± 3.0b 10 ± 6,0b 1 ± 1,0c 2 ± 2c 0d 30 ± 4.7AB 9 ± 6.5B 7 ± 5.8B 0d
AY — LH 20 ± 2,8B 35 ± 2,8A 18,3 ± 9B 15 ± 10b 5 ± 5,0 B 0C 0C 0C 0C 48,3 ± 6.0a 0C 0c 0c
Gene Руководство Направление Длина Длина (BP) TM (° C) GC% GC%
16S Tattgggggtaaagggggtgcgtagg 100 68 54.0
Форвард GCAGCCGCGGTAATACATA 62 52,6
Обратный GAGCATTGCACTTAGACCATAAAC 62 41,7
Bn актин-2 Зонд (Hex) TGCTGGATTCTGGTGATGGTGTGT 94 72 72 50.0
Forward Cagtggtcgtactactactgtgtattg 68 47.8 47.8
Revource Gatggcgtgtgaaagagagaga 6060650 50.0

Для количественного определения количества фитоплазмы в растениях использовали реакционную смесь для дуплексной ddPCR, состоящую из 12,5 мкл 2X ddPCR Super Mix for Probes, 16S и actin-2 M праймеров (конечная концентрация каждого праймера составляла 9000). ) и зонд (конечная концентрация каждого праймера составляла 250 нМ), использовали 1 мкл расщепленной ДНК (10 нг), доведенной до конечного объема 25 мкл с помощью ddH 2 O. Аликвоту объемом 20 мкл использовали для создания капель в 8-луночном картридже с использованием генератора капель QX100 (Bio-Rad, Плезантон, Калифорния).Капли переносили на 96-луночный планшет для ddPCR, запечатывали термосваркой (Bio-Rad) и амплифицировали в обычном термоциклере для ПЦР. Условия термоциклирования были следующими: 10 минутная денатурация при 95 °C, 50 циклов двухступенчатого термического профиля: 30 с денатурация при 94 °C и 1 минутный отжиг/наращивание при 58 °C. После амплификации продукты нагревали до 98°С в течение 10 мин для затвердевания капель, а затем охлаждали до 12°С. Капли количественно определяли в устройстве для считывания капель QX100 (Bio-Rad, Pleasanton, CA).Сбор и анализ данных проводили с использованием программного обеспечения QuantaSoft (Bio-Rad, Плезантон, Калифорния). Положительные капли, содержащие продукты амплификации, отличали от отрицательных капель путем установки порога амплитуды флуоресценции на самую низкую точку кластера положительных капель.

Для количественного определения числа копий фитоплазмы у насекомых была проведена однокомпонентная ddPCR с реакционной смесью, состоящей из 12,5 мкл 2X ddPCR Super Mix for Probes, праймеров 16S (конечная концентрация праймера 900 нМ) и зонда. (конечная концентрация каждого праймера составляла 250 нМ), 1 мкл расщепленной ДНК (10 нг) доводили до конечного объема 25 мкл с помощью ddH 2 O.Условия термоциклирования были такими же, как и у растительных образцов.

Статистический анализ

Для анализа влияния температуры и AY-инфекции на выживаемость взрослых особей цикадки в R 47 был проведен двухсторонний ANOVA. Средние значения разделяли с помощью теста Тьюки HSD (α = 0,05). Количество фитоплазм у цикад и растений анализировали с помощью логистического анализа PROC с использованием обобщенной линейной модели в SAS (версия SAS 9.1).

Благодарности

Мы благодарим Фонд развития растениеводства Альберты (ACIDF) и NSERC (MHB и TW) за финансовую поддержку.Мы признательны Ларри Гренкоу за помощь в статистическом анализе. Мы выражаем благодарность Россу Вайсу, Дане Нордин, Стин Кури, Саре Гани, Кейтлин Лудба, Кристин Хаммонд и Брайану Галке за техническую помощь.

Вклад авторов

М.Х.Б. разработал, выполнил и проанализировал эксперименты под руководством C.Y.O. и Д.Д.Х. и написал рукопись. Т.Дж.В. руководил экспериментом по размножению цикад, участвовал в графическом дизайне и статистическом анализе.Д.Р.Б. помогал с молекулярным анализом и редактировал рукопись. C.Y.O., D.D.H. и Т.Дж.В. отредактировал рукопись.

Примечания

Конкурирующие интересы

Авторы заявляют, что у них нет конкурирующих интересов.

Сноски

Примечание издателя: Springer Nature остается нейтральной в отношении юрисдикционных претензий в опубликованных картах и ​​институциональной принадлежности.

Ссылки

1. Lee I-M, Martini M, Marcone C, Zhu SF.Классификация штаммов фитоплазмы в группе вяза желтого (16SrV) и предложение « Candidatus Phytoplasma ulmi» для фитоплазмы, связанной с вязом желтым. Int J Syst Evol Microbiol. 2004; 54: 337–347. doi: 10.1099/ijs.0.02697-0. [PubMed] [CrossRef] [Google Scholar]

2. Фойссак, X. и Уилсон, М. Текущее и возможное будущее распространение фитоплазменных болезней и их переносчиков. В Phytoplasmas: геномы, растения-хозяева и векторы (изд. PG Weintraub & P. ​​Jones): 309–324, 10.1079/9781845935306.0309 (КАБИ, 2010).

3. Кункель Л.О. Исследования астр желтых. Являюсь. Дж. Бот. 1926; 13: 646–705. дои: 10.2307/2435474. [Перекрестная ссылка] [Академия Google]4. Кристенсен Н.М., Аксельсен К.Б., Николайсен М., Шульц А. Фитоплазмы и их взаимодействие с хозяевами. Тенденции Растениевод. 2005; 10: 526–535. doi: 10.1016/j.tplants.2005.09.008. [PubMed] [CrossRef] [Google Scholar]5. Оливье С.И., Лоури Д.Т., Стоббс Л.В. Фитоплазменные заболевания и их связь с насекомыми и растениями-хозяевами канадских садовых и полевых культур.Могу. Энтомол. 2009; 141:425–462. doi: 10.4039/n08-CPA02. [CrossRef] [Google Scholar]

6. IPCC. Изменение климата 2014: Обобщающий отчет. Вклад рабочих групп I, II и III в Пятый оценочный отчет Межправительственной группы экспертов по изменению климата (основная группа авторов под редакцией, Р.К. Пачаури и Л.А. Мейер). МГЭИК, Женева, Швейцария, 151 стр. (2014 г.).

7. Пармезан С. и др. Сдвиги к полюсу в географических ареалах видов бабочек связаны с региональным потеплением. Природа. 1999; 399: 579–583.дои: 10.1038/21181. [Перекрестная ссылка] [Академия Google]8. Будон-Падье, Э. и Майкснер, М. Потенциальные последствия изменения климата для распространения и активности насекомых-переносчиков возбудителей болезней виноградной лозы. In Глобальное потепление, которое может повлиять на виноградники 28–30, http://prodinra.inra.fr/record/24599 (2007).9. Магги Ф., Галетто Л., Марцаки С., Боско Д. Температурно-зависимая передача Candidatus Phytoplasma asteris цикадкой-переносчиком Macrosteles quadripuntulatus Kirschbaum.Энтомология. 2014;2:87–94. doi: 10.4081/энтомология.2014.202. [Перекрестная ссылка] [Академия Google] 10. Салар П., Шарентон С., Фуассак Х., Малембик-Махер С. Кинетика размножения фитоплазмы Flavescence dorée в бобах. Влияние штамма фитоплазмы и температуры. Евро. Дж. Плант Патол. 2013; 135:371–381. doi: 10.1007/s10658-012-0093-3. [Перекрестная ссылка] [Академия Google] 11. Овергаард Дж., Кристенсен Т.Н., Соренсен Дж.Г. 2012. Валидность анализов линейного изменения температуры, используемых для оценки термоустойчивости у членистоногих.ПЛОС ОДИН. 2012;7:e32758. doi: 10.1371/journal.pone.0032758. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]12. Тербланш Дж.С. и др. Экологически значимые меры устойчивости к потенциально смертельным температурам. Дж. Эксп. биол. 2011; 214:3713–3725. doi: 10.1242/jeb.061283. [PubMed] [CrossRef] [Google Scholar] 13. Бахар М.Х., Сорока Дж.Дж., Досдалл Л.М. Постоянная и флуктуирующая температуры во взаимодействиях между Plutella xylostella (Lepidoptera: Plutellidae) и ее личиночным паразитоидом Diadegma insulare (Hymenoptera: Ichneumonidae) Env.Энтомол. 2012;41:1653–1661. doi: 10.1603/EN12156. [PubMed] [CrossRef] [Google Scholar] 14. Руэл Дж. Дж., член парламента Эйреса. Неравенство Дженсена предсказывает влияние изменений окружающей среды. Тенденции Экол. Эвол. 1999; 14: 361–366. doi: 10.1016/S0169-5347(99)01664-X. [PubMed] [CrossRef] [Google Scholar] 15. Фишер К., Кольцов Н., Холтье Х., Карл И. Условия анализа в лабораторных экспериментах: оправдано ли использование постоянных, а не флуктуирующих температур при исследовании пластичности, вызванной температурой? Экология.2011; 166: 23–33. doi: 10.1007/s00442-011-1917-0. [PubMed] [CrossRef] [Google Scholar] 16. Garcia-Salazar C, Whalon ME, Rahardja U. Температурно-зависимая патогенность микоплазмоподобного организма X-болезни для его вектора, Paraphlepsius irroratus (Homoptera: Cicadellidae) Env. Энтомол. 1991; 20: 179–184. doi: 10.1093/ee/20.1.179. [CrossRef] [Google Scholar]

17. Прайс, П. В. Экологические аспекты устойчивости растений-хозяев и биологический контроль: взаимодействие между тремя трофическими уровнями, стр.11–30. В (ред. Д. Дж. Ботель и Р. Д. Эйкенберри) взаимодействие устойчивости растений, паразитоидов и хищников насекомых. Уайли, Нью-Йорк (1986).

18. Шапиро Л.Р., Зайдл-Адамс I, Де Мораес К.М., Стефенсон А.Г., Мешер М.С. Динамика краткосрочной и долгосрочной ассоциации между бактериальным патогеном растений и его членистоногим переносчиком. науч. Отчет 2014; 4:4155. doi: 10.1038/srep04155. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]19. Чуше Дж., Тьери Д. Холодные зимние температуры определяют динамику вылупления яиц переносчика болезни винограда.Натурвиссеншафтен. 2009; 96: 827–834. doi: 10.1007/s00114-009-0541-x. [Статья бесплатно PMC] [PubMed] [CrossRef] [Google Scholar]

20. Marcone, C. Движение фитоплазм и развитие болезней у растений, стр. 114–131. В Фитоплазмы: геном, растения-хозяева и переносчики. (редакторы Weintraub, PG & Jones, P.), CABI, Престон, Великобритания (2010).

21. Oropeza C, et al. Распределение фитоплазмы в кокосовых пальмах, пораженных смертельным пожелтением. Анна. заявл. биол. 2011; 159:109–117. doi: 10.1111/j.1744-7348.2011.00480.х. [Перекрестная ссылка] [Академия Google] 22. Презель Н., Николич П., Груден К., Равникар М., Дермастия М. Пространственно-временное распределение фитоплазмы Flavescence dorée в виноградной лозе. Завод Патол. 2013; 62: 760–766. doi: 10.1111/j.1365-3059.2012.02693.x. [Перекрестная ссылка] [Академия Google] 24. Мориссет Д., Стаебих Д., Милавек М., Груден К., Зел Дж. Количественный анализ образцов пищевых продуктов и кормов с помощью капельной цифровой ПЦР. ПЛОС ОДИН. 2013;8:e62583. doi: 10.1371/journal.pone.0062583. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]25.Racki N, Morisset D, Gutierrez-Aguirre I, Ravinkar M. Одноэтапная цифровая ПЦР с RT-каплями: прорыв в количественном определении переносимых через воду РНК-вирусов. Анальный биоанальный хим. 2014; 406: 661–667. doi: 10.1007/s00216-013-7476-y. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]26. Гутьеррес-Агирре И., Рачки Н., Дрео Т., Равникар М. Капельная цифровая ПЦР для абсолютного количественного определения патогенов. Методы Мол Биол. 2015;1302:331–347. doi: 10.1007/978-1-4939-2620-6_24. [PubMed] [CrossRef] [Google Scholar] 27.Копфли С. и др. Чувствительный и точный количественный анализ малярийных паразитов человека с использованием капельной цифровой ПЦР (ddPCR) Sci. Отчет 2016; 6: 39183. doi: 10.1038/srep39183. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]28. Baker M. Цифровая ПЦР набирает обороты. Нац. Мет. 2012; 9: 541–544. doi: 10.1038/nmeth.2027. [Перекрестная ссылка] [Академия Google] 29. Хейден Р.Т. и др. Сравнение капельной цифровой ПЦР с ПЦР в реальном времени для количественного обнаружения цитомегаловируса. Дж. Клин. микробиол. 2013; 51: 540–546. дои: 10.1128/JCM.02620-12. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]30. Меле Н., Дрео Т., Рабвинкар М. Количественный анализ фитоплазмы « Flavescence doree » с помощью капельной цифровой ПЦР. Фитопатогенные молликуты. 2014;4:9–15. doi: 10.5958/2249-4677.2014.00576.3. [Перекрестная ссылка] [Академия Google] 31. Перес-Лопес Э., Родригес-Мартинес Д., Оливье С.И., Луна-Родригес М., Дюмонсо Т.Дж. Молекулярно-диагностические анализы, основанные на последовательностях UT cpn60, показывают географическое распространение фитоплазмы подгруппы 16SrXIII-(A/I)I в Мексике.Научные отчеты. 2017;7 950:1–14. [Бесплатная статья PMC] [PubMed] [Google Scholar]33. Шер РБ, Шилдс Э.Дж. Картофельная цикадка (Homopteras: Cicadellidae) откладка яиц и развитие при низких колебаниях температуры. Окруж. Энт. 1991; 20:1113–1120. doi: 10.1093/ee/20.4.1113. [Перекрестная ссылка] [Академия Google] 34. Falzoi S, Lessio F, Spanna F, Alma A. Влияние температуры на эмбриональное и постэмбриональное развитие Scaphoideus titanus (Hemiptera: Cicadellidae), переносчика виноградной лозы Flavescence dorée .Междунар. Дж. Управлять вредителями. 2014;60:246–257. doi: 10.1080/09670874.2014.966170. [Перекрестная ссылка] [Академия Google] 35. Бинланд Л., Хой К.В., Миллер С.А., Нолт Л.Р. Влияние фитоплазмы астровых желтых на приспособленность цикадки астровой (Homoptera: Cicadellidae) Ann. Энтомол. Социально-Ам. 2000;93(2):271–276. doi: 10.1603/0013-8746(2000)093[0271:IOAYPO]2.0.CO;2. [Перекрестная ссылка] [Академия Google] 36. Murral DJ, Nault LR, Hoy CW, Madden LV, Miller SA. Влияние температуры и возраста вектора на передачу двух штаммов фитоплазмы Aster Yellows из штата Огайо цикадкой астровой (Homoptera: Cicadellidae) J.Экон. Энтомол. 1996;89(5):1223–1232. doi: 10.1093/jee/89.5.1223. [Перекрестная ссылка] [Академия Google] 37. Д’Амелио Р., Палермо С., Марцаки С., Боско Д. Влияние фитоплазмы желтых хризантем на приспособленность двух ее переносчиков цикад, Macrosteles quadripunctulatus и Euscelidius variegatus . Бык. инсектол. 2008; 61: 349–354. [Google Академия] 38. Талли Дж., Уиткомб Р., Кларк Х., Уильямсон Д. Патогенные микоплазмы: культивирование и патогенность позвоночных новой спироплазмы.Наука. 1977; 195: 892–894. doi: 10.1126/science.841314. [PubMed] [CrossRef] [Google Scholar] 39. Депутат Догерти, Боско Д., Алмейда РПП. Температура опосредует эффективность передачи переносчика: поступление инокулята и динамика заражения растений. Анна. заявл. биол. 2009; 155: 361–369. doi: 10.1111/j.1744-7348.2009.00346.x. [Перекрестная ссылка] [Академия Google] 40. Галетто Л., Марзаки К., Демикелис С., Боско Д. Растение-хозяин определяет способность передачи фитоплазмы Empoasca decipiens (Hemiptera: Cicadellidae).Дж. Экон. Энтомол. 2011; 104: 360–366. doi: 10.1603/EC10174. [PubMed] [CrossRef] [Google Scholar]

41. Olivier, C.Y. и другие. Выявление, симптоматика и лечение желтой астровой болезни канолы. В: Комплексная борьба с насекомыми-вредителями канолы и других масличных культур Brassica (изд. G.V.P. Reddy), 233–246 (CABI, 2017).

42. Оливье С.Ю., Эллиот Р.Х., Манн Л., Нордин Д. Разработка рейтинговой шкалы для желтой астры в каноле. Канадское обследование болезней растений. 2014;94:162–176. [Google Scholar]

43.Аноним. Информационный бюллетень о желтой астре, Министерство сельского хозяйства Саскачевана, Канада (2012 г.).

44. Стрингем Г.Р. Генетика четырех мутантов гипокотиля у Brassica campestris LJ Hered.

Добавить комментарий

Ваш адрес email не будет опубликован.